ID: 915167652_915167660

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 915167652 915167660
Species Human (GRCh38) Human (GRCh38)
Location 1:153957630-153957652 1:153957680-153957702
Sequence CCAACTCCCTAGAAAGCTCAGCA TCGGACGGTTACCCAGTTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!