ID: 915167653_915167660

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 915167653 915167660
Species Human (GRCh38) Human (GRCh38)
Location 1:153957636-153957658 1:153957680-153957702
Sequence CCCTAGAAAGCTCAGCAAACCAT TCGGACGGTTACCCAGTTGTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 187} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!