ID: 915170767_915170769

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 915170767 915170769
Species Human (GRCh38) Human (GRCh38)
Location 1:153975712-153975734 1:153975729-153975751
Sequence CCCTCTTCTTTCAGATATTCCAT TTCCATGCTACCCCCAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 444} {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!