ID: 915182712_915182717

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 915182712 915182717
Species Human (GRCh38) Human (GRCh38)
Location 1:154076992-154077014 1:154077027-154077049
Sequence CCCTCATAAGGGATCTTCCATGG ATCTTTCATCAGAAACCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 1, 2: 9, 3: 35, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!