ID: 915184016_915184019

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 915184016 915184019
Species Human (GRCh38) Human (GRCh38)
Location 1:154088616-154088638 1:154088632-154088654
Sequence CCTGTAACATCCCATACTGTTGT CTGTTGTTCTTCATAATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} {0: 1, 1: 0, 2: 2, 3: 32, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!