|
Left Crispr |
Right Crispr |
Crispr ID |
915187607 |
915187610 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:154120349-154120371
|
1:154120390-154120412
|
Sequence |
CCATCATTCTCAGCAAACTATCA |
CACCGTATGCTCTCACTCATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3456, 1: 11192, 2: 10129, 3: 4750, 4: 3607} |
{0: 3, 1: 158, 2: 5601, 3: 13584, 4: 6403} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|