ID: 915225003_915225018

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 915225003 915225018
Species Human (GRCh38) Human (GRCh38)
Location 1:154405562-154405584 1:154405603-154405625
Sequence CCTGCCGCCCGGTTCCCATTAGC CCATGGAGTGGTAGCCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71} {0: 1, 1: 0, 2: 3, 3: 6, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!