ID: 915231381_915231390

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 915231381 915231390
Species Human (GRCh38) Human (GRCh38)
Location 1:154448158-154448180 1:154448180-154448202
Sequence CCACCCCCATGCAGGTGAGCTCC CTGTTCTTGTAAAAGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 257} {0: 1, 1: 1, 2: 0, 3: 16, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!