ID: 915235294_915235297

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 915235294 915235297
Species Human (GRCh38) Human (GRCh38)
Location 1:154475956-154475978 1:154475993-154476015
Sequence CCAGCCCATTGTATTAGTTTCTA TCTCCATTTTAAAACGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 354} {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!