ID: 915261053_915261059

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 915261053 915261059
Species Human (GRCh38) Human (GRCh38)
Location 1:154677323-154677345 1:154677345-154677367
Sequence CCAAAACCACCGAGGCCTAGACC CTCCTCACTGCTGCGAAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 140, 2: 94, 3: 49, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!