ID: 915272879_915272884

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 915272879 915272884
Species Human (GRCh38) Human (GRCh38)
Location 1:154767618-154767640 1:154767654-154767676
Sequence CCACCAGTAAAGCTGCTTGGCAC ATCAGGAGGTTCCTCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99} {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!