ID: 915275519_915275534

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 915275519 915275534
Species Human (GRCh38) Human (GRCh38)
Location 1:154785422-154785444 1:154785475-154785497
Sequence CCTTCACCTCCTTCCCAAGGGCC TTTCCTGATCTCCCAGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 545} {0: 1, 1: 1, 2: 3, 3: 16, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!