ID: 915276112_915276129

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 915276112 915276129
Species Human (GRCh38) Human (GRCh38)
Location 1:154789364-154789386 1:154789410-154789432
Sequence CCCTTTTGCCAGGATATCCAGGG GGGTGGTGGTCGGTGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 160} {0: 1, 1: 0, 2: 5, 3: 95, 4: 732}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!