ID: 915278559_915278560

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 915278559 915278560
Species Human (GRCh38) Human (GRCh38)
Location 1:154806864-154806886 1:154806880-154806902
Sequence CCAGGGAGGTGAGGAAGGAAGCA GGAAGCAGCCATTCCCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 110, 4: 539} {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!