ID: 915279875_915279883

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 915279875 915279883
Species Human (GRCh38) Human (GRCh38)
Location 1:154815078-154815100 1:154815128-154815150
Sequence CCATCTGCTCATCACACCTGAGT CAGGCTGAGAAGTCTGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 187} {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!