ID: 915297502_915297510

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 915297502 915297510
Species Human (GRCh38) Human (GRCh38)
Location 1:154931560-154931582 1:154931604-154931626
Sequence CCTGTCTTTCCCATGCAGTGCAG AACAGTGCTGAACATGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 242} {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!