ID: 915302956_915302963

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 915302956 915302963
Species Human (GRCh38) Human (GRCh38)
Location 1:154961938-154961960 1:154961971-154961993
Sequence CCAGCTCACCGAGGGGCGGCAGC GCTGCCGGACCGTACCATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 142} {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!