ID: 915312589_915312599

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 915312589 915312599
Species Human (GRCh38) Human (GRCh38)
Location 1:155011828-155011850 1:155011866-155011888
Sequence CCTGGCAGAAAGAAGGGGGAGGC CCCTCCCAGATGATGGGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 430} {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!