ID: 915325830_915325843

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 915325830 915325843
Species Human (GRCh38) Human (GRCh38)
Location 1:155080760-155080782 1:155080798-155080820
Sequence CCGGGAGCCTCCTTTCTGTCCTC CCTGGGCCGGCAGAGGTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 481} {0: 1, 1: 0, 2: 2, 3: 61, 4: 1034}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!