ID: 915349451_915349459

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 915349451 915349459
Species Human (GRCh38) Human (GRCh38)
Location 1:155215267-155215289 1:155215309-155215331
Sequence CCTGTGAGGGGCACATTCCTTAG GTGAAGATCCAGGCATCTCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 8, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!