ID: 915361385_915361389

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 915361385 915361389
Species Human (GRCh38) Human (GRCh38)
Location 1:155288184-155288206 1:155288199-155288221
Sequence CCTATCCCGGGCAGGGCGCTCCC GCGCTCCCAGGTCTCCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129} {0: 1, 1: 0, 2: 0, 3: 21, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!