ID: 915366365_915366367

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 915366365 915366367
Species Human (GRCh38) Human (GRCh38)
Location 1:155319016-155319038 1:155319029-155319051
Sequence CCCTGGTGAAAAACTGTGTGACC CTGTGTGACCTTGAGCAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187} {0: 2, 1: 7, 2: 44, 3: 107, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!