ID: 915463987_915463992

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 915463987 915463992
Species Human (GRCh38) Human (GRCh38)
Location 1:156085258-156085280 1:156085300-156085322
Sequence CCTTGAGGAGCTGGATTCTCAGA CGCTCTCTCCCGGAGGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 239} {0: 1, 1: 0, 2: 1, 3: 50, 4: 1247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!