ID: 915468122_915468127

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 915468122 915468127
Species Human (GRCh38) Human (GRCh38)
Location 1:156109593-156109615 1:156109638-156109660
Sequence CCAGTTCTGCACTGGGCCTGTTA GTCAGCCTCATCTGCAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131} {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!