ID: 915468122_915468128

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 915468122 915468128
Species Human (GRCh38) Human (GRCh38)
Location 1:156109593-156109615 1:156109639-156109661
Sequence CCAGTTCTGCACTGGGCCTGTTA TCAGCCTCATCTGCAAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131} {0: 1, 1: 0, 2: 7, 3: 43, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!