ID: 915488727_915488733

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 915488727 915488733
Species Human (GRCh38) Human (GRCh38)
Location 1:156239890-156239912 1:156239903-156239925
Sequence CCCCCCTCCTGCTGGTTCCCCAG GGTTCCCCAGCCCTTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 50, 4: 559} {0: 1, 1: 0, 2: 2, 3: 41, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!