ID: 915490428_915490442

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 915490428 915490442
Species Human (GRCh38) Human (GRCh38)
Location 1:156247395-156247417 1:156247438-156247460
Sequence CCGGCACATTCCTTGGCACAAGT GCAGGCGGAGCCGCCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 173} {0: 1, 1: 0, 2: 5, 3: 23, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!