|
Left Crispr |
Right Crispr |
| Crispr ID |
915504033 |
915504038 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:156340920-156340942
|
1:156340951-156340973
|
| Sequence |
CCTTGATTCAAGTGATTCTTGTG |
ACCCAAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 220, 2: 3270, 3: 18387, 4: 93816} |
{0: 603, 1: 51185, 2: 147346, 3: 249353, 4: 527634} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|