ID: 915508400_915508406

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 915508400 915508406
Species Human (GRCh38) Human (GRCh38)
Location 1:156371929-156371951 1:156371947-156371969
Sequence CCCTAGGTTTCCATTCCTGTGGA GTGGACTTGGATACTGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 273} {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!