ID: 915543160_915543166

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 915543160 915543166
Species Human (GRCh38) Human (GRCh38)
Location 1:156581603-156581625 1:156581622-156581644
Sequence CCTGCGCCTTCAACCTGGGGGCT GGCTGCCTATGTGGAGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128} {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!