ID: 915544902_915544921

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 915544902 915544921
Species Human (GRCh38) Human (GRCh38)
Location 1:156591704-156591726 1:156591755-156591777
Sequence CCGGAATCCGCGCGTGCTGGCCC CACATGCGCCGGGGCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48} {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!