ID: 915544904_915544927

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 915544904 915544927
Species Human (GRCh38) Human (GRCh38)
Location 1:156591711-156591733 1:156591763-156591785
Sequence CCGCGCGTGCTGGCCCGGCCTCT CCGGGGCCGGGCCGGGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 163} {0: 3, 1: 4, 2: 44, 3: 221, 4: 1349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!