ID: 915544912_915544915

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 915544912 915544915
Species Human (GRCh38) Human (GRCh38)
Location 1:156591724-156591746 1:156591744-156591766
Sequence CCCGGCCTCTTCGGGGGCGGGGC GGCGAGCGCCGCACATGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199} {0: 1, 1: 0, 2: 0, 3: 7, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!