ID: 915544914_915544922

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915544914 915544922
Species Human (GRCh38) Human (GRCh38)
Location 1:156591729-156591751 1:156591756-156591778
Sequence CCTCTTCGGGGGCGGGGCGAGCG ACATGCGCCGGGGCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125} {0: 1, 1: 0, 2: 0, 3: 24, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!