ID: 915544914_915544924

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 915544914 915544924
Species Human (GRCh38) Human (GRCh38)
Location 1:156591729-156591751 1:156591761-156591783
Sequence CCTCTTCGGGGGCGGGGCGAGCG CGCCGGGGCCGGGCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125} {0: 1, 1: 6, 2: 58, 3: 354, 4: 1578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!