|
Left Crispr |
Right Crispr |
| Crispr ID |
915563763 |
915563770 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:156702654-156702676
|
1:156702686-156702708
|
| Sequence |
CCCAGCTGCTCGGGAGGCTGAGG |
CACTTGAATCCAGGAGACGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2765, 1: 111227, 2: 293718, 3: 226548, 4: 225970} |
{0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|