ID: 915596363_915596373

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 915596363 915596373
Species Human (GRCh38) Human (GRCh38)
Location 1:156898526-156898548 1:156898555-156898577
Sequence CCTGTGGAGTGCAGCAGGCTGCT GCTCCCTGTGTAGGGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 177} {0: 1, 1: 1, 2: 3, 3: 43, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!