ID: 915597299_915597308

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 915597299 915597308
Species Human (GRCh38) Human (GRCh38)
Location 1:156902890-156902912 1:156902909-156902931
Sequence CCCATTTCCGAATGGCTGACAGG CAGGGCAGTCTGAGGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 1, 3: 57, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!