ID: 915599581_915599592

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 915599581 915599592
Species Human (GRCh38) Human (GRCh38)
Location 1:156913879-156913901 1:156913924-156913946
Sequence CCAGTGTGGCTTCCCTGAGCAGT GGGACCTGCCCAGCTTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 288} {0: 1, 1: 0, 2: 1, 3: 19, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!