ID: 915599582_915599592

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 915599582 915599592
Species Human (GRCh38) Human (GRCh38)
Location 1:156913891-156913913 1:156913924-156913946
Sequence CCCTGAGCAGTGAGAACCCATAT GGGACCTGCCCAGCTTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134} {0: 1, 1: 0, 2: 1, 3: 19, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!