ID: 915599586_915599599

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915599586 915599599
Species Human (GRCh38) Human (GRCh38)
Location 1:156913907-156913929 1:156913934-156913956
Sequence CCCATATGCCACCATCCGGGACC CAGCTTGCCAGGGGGCCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64} {0: 1, 1: 0, 2: 2, 3: 25, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!