ID: 915603964_915603967

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 915603964 915603967
Species Human (GRCh38) Human (GRCh38)
Location 1:156939381-156939403 1:156939399-156939421
Sequence CCAAAGCCTGCCTGATATCGGCG CGGCGTTGTCTCCTTCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46} {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!