ID: 915604112_915604115

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 915604112 915604115
Species Human (GRCh38) Human (GRCh38)
Location 1:156940084-156940106 1:156940097-156940119
Sequence CCATCTCTCCTCAAGCACACCAG AGCACACCAGGAAGAGCCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 635} {0: 1, 1: 0, 2: 0, 3: 17, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!