ID: 915612637_915612645

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 915612637 915612645
Species Human (GRCh38) Human (GRCh38)
Location 1:157006836-157006858 1:157006887-157006909
Sequence CCAGAAGATGAAGGGCCCCAGTG CTGTGCCACAGGCCTAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168} {0: 1, 1: 0, 2: 1, 3: 20, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!