ID: 915615413_915615425

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 915615413 915615425
Species Human (GRCh38) Human (GRCh38)
Location 1:157034114-157034136 1:157034138-157034160
Sequence CCTAGTGGTATTTTTCCCCTCTC CTGGGGCTCTGAAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 372} {0: 1, 1: 0, 2: 1, 3: 60, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!