ID: 915619812_915619823

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 915619812 915619823
Species Human (GRCh38) Human (GRCh38)
Location 1:157074298-157074320 1:157074337-157074359
Sequence CCAACGCCAAGTTGTCCGAGCTG GGGCCAAGCAGGACATGTTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 24, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!