ID: 915656910_915656920

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 915656910 915656920
Species Human (GRCh38) Human (GRCh38)
Location 1:157368309-157368331 1:157368357-157368379
Sequence CCTTTCCTTAGAATCAGGTGCCT CCCTGGACCTGAGCTGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!