ID: 915681661_915681664

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 915681661 915681664
Species Human (GRCh38) Human (GRCh38)
Location 1:157587256-157587278 1:157587277-157587299
Sequence CCTGGCTCTCCAACACTCACGCT CTGCACATGGATCTGTAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149} {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!