ID: 915682341_915682344

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 915682341 915682344
Species Human (GRCh38) Human (GRCh38)
Location 1:157593519-157593541 1:157593548-157593570
Sequence CCTCTTACTTGAGGCCTAGTTAT TCTTGAAAACATGTATGCATGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 33, 3: 67, 4: 106} {0: 1, 1: 2, 2: 5, 3: 50, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!