ID: 915734143_915734152

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 915734143 915734152
Species Human (GRCh38) Human (GRCh38)
Location 1:158074131-158074153 1:158074178-158074200
Sequence CCCAGGATCTCAGCACCTGCCAC CTTTAGAAGACATGAATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 814} {0: 1, 1: 0, 2: 2, 3: 33, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!